Iranian Journal of Medical Sciences

Document Type: Original Article(s)

Authors

1 Departments of Microbiology, Faculty of Life Sciences and Technology, Shahid Beheshti University, Tehran, Iran

2 Research Center for Food Hygiene and Safety, Shahid Sadoughi University of Medical Sciences, Yazd, Iran

Abstract

Background: Community-acquired infections by multidrug-resistant (MDR), extended-spectrum β-lactamase (ESBL) producing Klebsiella species (Klebsiella spp.) is of major concern worldwide. Antibiotic resistance, production of extended-spectrum β-lactamases (ESBLs), and carbapenemases, as well as the presence of classes 1, 2, and 3 integrons in outpatient isolates of Klebsiella collected from Yazd central laboratory, Yazd, Iran.
Methods: We collected 250 Klebsiella isolates from Yazd central laboratory between August 2015 and October 2017. Antibiotic susceptibility was determined against 18 antibiotics by disc diffusion, and multidrug-resistant isolates were tested for ESBL production by the phenotypic confirmatory test according to CLSI 2017 protocols. The amplification of β-lactamase genes blaSHV, blaTEM, blaCTX-M, blaOXA-48, blaKPC, and blaNDM, classes 1, 2, and 3 integrase genes, was carried out using specific primers and polymerase chain reaction (PCR).
Results: Of the 250 Klebsiella outpatient isolates, 3.6% were K. oxytoca and the rest were K. pneumoniae. Disc diffusion showed that 21 (8.4%) isolates were MDR, 19 (90.4%) of which were ESBL producers including one K. oxytoca. The most prevalent β-lactamase gene was blaSHV followed by blaTEM and blaCTX-M, but blaOXA-48, blaKPC, and blaNDM were not detected. Class 1 integron was detected in 18 out of 21 MDR isolates (85.7%), but classes 2 and 3 were not observed. Two isolates were resistant to carbapenems and harbored blaSHV, blaTEM, and blaCTX-M, as well as class 1 integron.
Conclusion: ESBL production and the presence of multiple β-lactamase genes in MDR community isolates of Klebsiella spp. can have significant implications in terms of the spread of these opportunistic pathogens.

Keywords

What’s Known

The presence of integron-mediated, multidrug-resistant, extended-spectrum β-lactamase producing Klebsiella in the community has significant implications in the spread of these opportunistic pathogens between the community and health centers worldwide. Most studies have reported the prevalence of these resistance determinants in clinical isolates, and studies on community isolates are few in Iran.

What’s New

This is the first study showing that 8.4% and 7.6% of the Iranian Klebsiella outpatient isolates were multidrug-resistant and extended-spectrum β-lactamase producers, respectively. The presence of multiple β-lactamase genes and class 1 integron in 85.7% of these isolates shows the need for molecular characterization of community isolates in Iran.

Introduction

Klebsiella spp. isolates are important opportunistic pathogens and the cause of nosocomial as well as community-acquired infections including pneumonia, urinary tract and wound infections, gastrointestinal diseases, and septicemia. 1 - 3 A wide range of β-lactam antibiotics is commonly used for the treatment of Klebsiella related infections. However, the frequent use of antibacterial agents has led to the emergence of resistance mostly due to the extended-spectrum β-lactmases (ESBLs) production by the organisms worldwide. 4 , 5 ESBLs hydrolyze extended spectrum β-lactam antibiotics and aztreonam. 6 Furthermore, ESBL producing K. pneumoniae are often resistant to non-β-lactam antibiotics such as aminoglycosides and fluoroquinolones, leading to the emergence of multidrug-resistant (MDR) strains. 6 , 7 The major groups of ESBLs, commonly detected among both community and hospital-acquired isolates of Klebsiella spp., belong to SHV, TEM, and CTX-M classes. 4 , 7 , 8 Another class of antibiotics, carbapenems, has also been extensively used to treat ESBL producing Klebsiella related infections. However, carbapenemase-producing isolates with reduced susceptibility or resistance to carbapenems have restricted the use of these antibiotics. 9 Functional carbapenemases include K. pneumoniae carbapenemase (KPC), Metallo-β-lactamases, and oxacillinase. 10 - 12 Of these, KPC-producing K. pneumoniae is most frequently associated with high mortality rates. 13 The genes encoding ESBL resistance along with a number of other antibiotic resistance determinants are often found on class I integrons and are usually carried by plasmids. 14 , 15 The presence of multiple resistance determinants on mobile genetic elements allows for the spread of the organism in large populations and can cause serious community and/or hospital-acquired infections. 16 Considering that the majority of studies have been performed on nosocomial Klebsiella isolates, we studied the antibiotic resistance profiles of community isolates of Klebsiella followed by the detection of ESBL and carbapenemase production, as well as the presence of class 1, 2, and 3 integrons in MDR isolates collected from outpatient specimens in Yazd central laboratory, Yazd, Iran.

Materials and Methods

Isolation and Identification of Bacteria

In this study, a total of 250 Klebsiella isolates were collected from outpatients (age range of 23 to 87 years old) at the central laboratory in Yazd, Iran, between August 2015 and October 2017. Conventional biochemical tests were used to confirm the identity of the isolates, which were then maintained in Tryptic Soy Broth (TSB; Merck, Germany), containing 4% glycerol (Merck, Germany) at −70 °C.

Antibacterial Susceptibility

Susceptibility against 18 antibiotics was performed by disc diffusion according to the 2017 CLSI guidelines using commercially available discs (Mast, UK) including amoxicillin (AMX, 10 μg), cefalotin (CF, 30 μg), ceftazidime (CAZ, 30 μg), cefotaxime (CTX, 30 μg), gentamicin (GM, 10 μg), nalidixic acid (NA, 30 μg), kanamycin (KM, 30 μg), amikacin (AN, 30 μg), trimethoprim/sulfamethoxazole (SXT, 23.75/1.25 μg), ciprofloxacin (CIP, 30 μg), ofloxacin (OFX, 5 μg), norfloxacin (NOR, 10 μg), nitrofurantoin (NF, 300 μg), imipenem (IMP, 10 μg), meropenem (MEM, 10 μg), ertapenem (ETP 10μg), tetracycline (TE, 30 μg), and chloramphenicol (CM, 30 μg). 17K. pneumoniae ATCC 10031 was used as the susceptible control. MDR was recorded when the isolates were resistant to at least three classes of antibiotics.

Screening for ESBL Production

ESBL production was detected by the phenotypic confirmatory test (PCT) using ceftazidime (30 μg) and cefotaxime (30 μg) alone or in combination with clavulanic acid (10 μg) (Mast, UK), as recommended by the CLSI 2017 guidelines. 17 An increase of >5 mm in the zone diameter of the antibiotic in combination with clavulanic acid, compared to the antibiotic alone, was re­corded as ESBL production. K. pneumoniae ATCC 10031 was used as the susceptible control for ESBL production.

Determination of Minimum Inhibitory Concentrations

Minimum inhibitory concentrations (MICs) for imipenem were measured for imipenem-resistant and intermediately resistant isolates by the Epsilometer test (E-test, Liofilchem, Italy) according to the CLSI 2017 guidelines. 17

Phenotypic Detection of Carbapenemase Activity

Carbapenemase production was detected by the Modified Hodge Test (MHT). 17 Briefly, a 1:10 dilution of an overnight grown E. coli ATCC 25922 culture (turbidity adjusted to McFarland no. 0.5) was used to make a bacterial lawn on the surface of a Mueller Hinton agar (Merck, Germany) plate and a meropenem or ertapenem disc (10 μg) was placed in the center of the test area. Carbapenem-resistant test isolates were then streaked from the edge of the disc to the edge of the plate. After overnight incubation at 37 oC, carbapenemase production was confirmed if a cloverleaf-like distortion of the inhibition zone was observed.

DNA Extraction and Amplification

Bacterial genomic DNA was extracted directly by boiling. Briefly, a loopful of bacteria grown overnight on MacConkey agar (Merck, Germany) was resuspended in 500 µl of sterile double distilled water, boiled for 10 minutes, and centrifuged at 10,000 g for 10 minutes. The supernatant was used as DNA template for PCR amplification.

Primers used for the amplification of β-lactamase genes (blaSHV, blaTEM, blaCTX), carbapenemases (blaOXA-48, blaKPC and blaNDM), integron classes 1, 2, and 3 genes are shown in table 1. 18 - 21 Thermocycler (Applied Biosystems, USA) conditions are also shown in table 1. Each PCR reaction mixture (25 μl) contained 1.5 μl DNA template, 1.5 mM MgCl2, 0.25 mM of dNTP mix (Cinnagen, Iran), 1 unit of DFS-Taq DNA polymerase (Bioron, Germany), and 20 pmol of each primer (Faza Biotech, Iran). PCR amplification products were run on 1.5% agarose gels and visualized using Gel Documentation System (ATP, Iran). PCR products were sequenced (Pishgam, Tehran, Iran) and accession numbers were obtained from the Genbank. Positive controls for PCR experiments were chosen from the verified sequenced PCR products.

Gene Primer Sequence PCR Product (bp) Thermocycler conditions Ref
Denaturation Annealing Extension Cycles
blaTEM-F GAGTATCAACATTTCCGTGTC 889 94º 45º 72º 32 18
blaTEM-R TAATCAGTGAGGCACCTTCTC 1 min 1 min 1 min
blaCTX-M-F CGCTTTGCGATGTGCAG 550 94º 63º 72º 32 18
blaCTX-M-R ACCGCGATATCGTTGGT 1 min 1 min 1 min
blaSHV-F ATGCGTTATATTCGCCTGTG 862 94º 58º 72º 32 19
blaSHV-R AGCGTTGCCAGTGCTCGATC 1 min 1 min 1 min
blaKPC-F TGTTGCTGAAGGAGTTGGGC 340 95º 56º 72º 35 20
blaKPC -R ACGACGGCATAGTCATTTGC 1 min 1 min 1 min
blaOXA-48-F TTGGTGGCATCGATTATCGG 585 95º 56º 72º 35 20
blaOXA-48-R GAGCACTTCTTTTGTGATGGC 1 min 1 min 1 min
blaNDM-F TAAAATACCTTGAGCGGGC 439 95º 52º 72º 35 20
blaNDM-R AAATGGAAACTGGCGACC 1 min 1 min 1 min
Int1-F CCTCCCGCACGATGATC 280 94º 60º 72º 35 21
Int1-R TCCACG­CATCGTCAGGC 1 min 1 min 1 min
Int2-F TTATTGCTGGGATTAGGC 233 94º 60º 72º 35 21
Int2-R AC­GGCTACCCTCTGTTATC 1 min 1 min 1 min
Int3-F AGTGGGTGGCGAATGAGTG 600 94º 60º 72º 35 21
Int3-R TGTTCTTGTATCGGCAGGTG 1 min 1 min 1 min
Table1. Primers and temperatures used for the detection of β-lactamases, carbapenemases, and integrase genes

Results

Of the 250 Klebsiella outpatient isolates, nine (3.6%) were K. oxytoca and the rest were identified as K. pneumoniae. Among these, 245 (98%) were obtained from urine and five (2%) were from wound and sputum specimens. Disc diffusion results showed that resistance rates to the test antibiotics ranged from 0.4% to 12.8% (table 2). Multidrug-resistance (resistance to at least three antibiotic classes including β-lactams) was observed in 21 (8.4%) isolates (table 3). Two isolates were intermediately resistant to imipenem; one of which was also intermediately resistant to ertapenem and the other was resistant to meropenem. Among the 21 MDR isolates (table 3), one was K. oxytoca and the rest were K. pneumoniae. MIC measurements for imipenem confirmed the disc diffusion results (MICs of 2 to 3 mg/L).

Antibiotic Resistant No (%) Intermediate No (%) Susceptible No (%)
Amoxicillin 250 (100) 0 (0) 0 (0)
Cefalotin 27 (10.8) 1 (0.4) 222 (88.8)
Ceftazidime 10 (4) 9 (3.6) 231 (92.4)
Cefotaxime 12 (4.8) 7 (2.8) 231 (92.4)
Imipenem 0 (0) 2 (0.8) 248 (99.2)
Meropenem 1 (0.4) 0 (0) 249 (99.6)
Ertapenem 0 (0) 2 (0.8) 248 (99.2)
Gentamicin 11 (4.4) 1 (0.4) 238 (95.2)
Amikacin 3 (1.2) 1 (0.4) 246 (98.4)
Kanamycin 10 (4) 2 (0.8) 238 (95.2)
Nalidixic acid 19 (7.6) 6 (2.4) 225 (90)
Ciprofloxacin 12 (4.8) 5 (2) 233 (93.2)
Ofloxacin 12 (4.8) 2 (0.8) 236 (94.4)
Norfloxacin 10 (4) 2 (0.8) 238 (95.2)
Nitrofurantoin 7 (2.8) 0 (0) 243 (97.2)
Chloramphenicol 4 (1.6) 1 (0.4) 245 (98)
Tetracycline 18 (7.2) 4 (1.6) 228 (91.2)
Trimethoprim-Sulfamethoxazole 32 (12.8) 0 (0) 218 (87.2)
Table2. Antibacterial susceptibility of 250 community isolates of Klebsiella spp., measured by disc diffusion
Isolate No. Phenotypic confirmatory test (PCT) β-lactamase genes Class 1 Integron Antibiotic resistance profile (disc diffusion)
Kp 9 + CTX, TEM, SHV - AMX, CF, CTX, CM, NA, TE, SXT, CIPI, OFXI
Kp 11 + CTX, TEM, SHV + AMX, CF, CTX, CAZ, IMPI, MEM, GM, AN, KMI, NA, TE, SXT, CIPI, OFXI
Kp 24 + CTX, TEM, SHV + AMX, CF, CTX, CAZ, GM, ANI, KM, TEI, SXT,
Kp 31 + TEM, SHV + AMX, CF, CAZ, CTXI, CIPI, TE, SXT
Kp 42 + CTX, TEM, SHV + AMX, CF, CAZ, CTX, GM, AK, KM, NA, CIP, OFX, NF, TE, SXT
Ko 55 + CTX, TEM, SHV + AMX, CF, CAZ, CTX, CIP, OFX, NA, KM, NF, TE, SXT
Kp 63 + CTX, TEM, SHV + AMX, CF, CAZI, CTXI, CIPI, OFXI, NF, TE, SXT
Kp 70 + TEM, SHV + AMX, CF, CAZ, CTXI, GM, KMI, CIP, OFX, NF, NA,TE, SXT
Kp 84 + CTX, TEM, SHV + AMX, CF, CTX, GM, TEI
Kp 93 + TEM, SHV + AMX, CF, CAZI, NA, TE, SXT
Kp 98 - TEM, SHV - AMX, CF, CAZI, NAI, TE, SXT
Kp 118 + CTX, TEM, SHV + AMX, CF, CAZI, CTX, KM, SXT
Kp 137 - TEM, SHV - AMX, CF, CTXI, NOR, CM, SXT
Kp 142 + CTX, TEM, SHV + AMX, CF, CTXI, CAZ, ETPI, IMPI, CIP, OFX, NA, KM, NF, CM, TE, SXT
Kp 163 + CTX, SHV + AMX, CF, CAZI, CTX, KM, CM, SXT
Kp 173 + CTX, TEM, SHV + AMX, CF, CTX, GM, KM, SXT
Kp 192 + CTX + AMX, CF, CAZI, CTXI, CIP, OFX, NA, NF, SXT
Kp 213 + CTX, TEM, SHV + AMX, CF, CAZI, CTXI, NAI, SXT
Kp 229 + CTX + AMX, CF, CAZI, CTXI, GM, CIP, OFX, NA, NF, SXT
Kp 230 + CTX, SHV + AMX, CF, CAZI, CTX, SXT
Kp 234 + CTX, TEM, SHV + AMX, CF, CAZ, CTX, CIP, OFX, NA, GM, KM, NF, TE, SXT
Table3. Characterization of β-lactamase-producing of Klebsiella spp. outpatient isolates

Phenotypic confirmatory test results (table 3) showed that 19 of the 21 isolates (90.4%) were ESBL producers, 17 of which were from urine, one was from sputum and one from a wound specimen. All ESBL producing MDR isolates recovered from urine were from female patients over 60 years of age. Sequence analyses of the PCR products obtained from ESBL producing isolates by the PCT confirmed the identity of genes. Figure 1 shows the PCR amplification products of β-lactamase and int1 genes in outpatient isolates of Klebsiella. PCR results revealed that all 21 MDR isolates carried at least one β-lactamase gene, 18 of which were positive for class 1 integron. Classes 2 and 3 integrons were not detected. As it can be observed from table 3, 19 isolates (90.5%) harbored the blaSHV gene, 17 (80.9%) had blaTEM, and 16 (76.2%) carried the blaCTX-M gene. The two isolates that contained both blaSHV and blaTEM were negative for ESBL production by the phenotypic methods and did not carry class 1 integron.

Figure1. The figure displays the PCR amplification of ESBL and int1 genes in outpatient isolates of Klebsiella spp. Lane 1, int1 (280 bp), C1+ (KP234, Genbank Accession No. MH369808). Lane 2, blaTEM (889 bp), C2+ (KP24, Genbank Accession No. MH369809). Lane 3, blaSHV (862 bp), C3+ (KP70, Genbank Accession No. MH487650). Lane 4, blaCTX-M, (550 bp), C4+ (KP229, Genbank Accession No. MH469722). L, 50 bp DNA ladder. C-, negative control.

The MHT results showed that the two isolates were carbapenemase producers, both of which harbored ESBL genes (blaCTX-M, blaSHV, and blaTEM genes) as well as class 1 integron (Kp 11 and Kp 142). The other carbapenemase genes (blaKPC, blaOXA-48, and blaNDM) were not detected.

Discussion

The emergence of ESBL producing K. pneumoniae among the community isolates is a major concern and an important cause of failure in antibiotic therapy. In this research, 21/250 (8.4%) of the Klebsiella spp. isolated from outpatients were MDR, among which 19 (90.5%) were ESBL producers including one K. oxytoca. In a study from Saudi Arabia, among 955 outpatient isolates, 30% and 2% were K. pneumoniae and K. oxytoca, respectively, with similar rates of ESBL production. They also reported that ESBL producing isolates were mostly obtained from urine specimens of subjects over the age of 60. 22 In the present study, almost all of ESBL producing MDR strains were urinary isolates obtained from female patients over 60 years old, showing a significant relationship between the patients age, multidrug-resistance, and ESBL production in Klebsiella-related infections. These results suggest that elderly patients may have been repeatedly exposed to previous uses of antibiotics including the broad-spectrum β-lactams. 22 Due to the high frequency of K. pneumoniae-related nosocomial and community-acquired infections, almost all research has been conducted on this organism. 4 , 16 , 23

In this study, ESBL-positive isolates were also MDR. However, the non-ESBL isolates were susceptible to almost all classes of antibiotics. For example, all ESBL producers were resistant to trimethoprim-sulfamethoxazole, compared to 4.8% of non-ESBL isolates (data not shown). Our results are in line with those of a study from Japan showing that nosocomial as well as ESBL producing community isolates of K. pneumoniae were also multidrug-resistant. 24 On the other hand, almost all our ESBL producing MDR isolates were susceptible to carbapenems, suggesting that these antibiotics could still be the drugs of choice for the treatment of infections caused by ESBL producing Klebsiella spp. In agreement with our results, Bouchillon and colleagues reported that ESBL producing community Enterobacteriaceae isolates were susceptible to carbapenems. 25

The rate of ESBL production in our outpatient isolates of K. pneumoniae was similar to those reported from Taiwan (7.6%), Japan (8.5-9.2%), and the United States. 23 - 25 However, the high levels of ESBL producing K. pneumoniae community isolates have been reported worldwide. 26 - 31

The majority of investigations suggest that among ESBL classes produced by K. pneumoniae community isolates, three (SHV, TEM, and CTX-M) seem to be the most common types. 4 , 7 , 8 In the current study, SHV was the most prevalent type of β-lactamase (90.5%), followed closely by TEM (80.9%) and CTX-M (76.2%). The predominance of SHV type ESBL in our community isolates is similar to some other reports from Iran. 26 , 32 On one hand, the majority of the studies have reported CTX-M as the most prevalent ESBL in K. pneumoniae community isolates. 16 , 23 , 29 , 31 On the other hand, some Iranian studies have shown TEM as the prevalent ESBL in K. pneumoniae. 8 , 27 In a recent study from Isfahan, Maleki et al. showed that 25.5% of the outpatient isolates were ESBL producers, 92% of which had MDR phenotype with high rates of blaCTX-M (92%) and blaTEM (76%) gene carriage. 33 Furthermore, we also found that 12 of our 19 ESBL producing Klebsiella isolates (63.1%), including one K. oxyteca, contained all three β-lactamase genes. As in this research, other investigators have shown the presence of multiple ESBL genes in the community urinary isolates of K. pneumoniae. 8 , 23 , 28 , 33 The differences observed in the prevalence of ESBL genes, found in Klebsiella isolates from different nosocomial or community settings, could be due to the presence of genetic elements such as integrons, which facilitate the dissemination of ESBL genes by horizontal transfer in different geographical regions.

The outpatient isolates of this study did not harbor carbapenemase encoding genes blaOXA48, blaKPC, and blaNDM genes, similar to what was reported by van Hoek in the Netherlands. 34 However, other studies have reported the presence of blaKPC, blaNDM, and blaOXA-48 among community isolates of K. pneumoniae. 11 , 35 , 36 In this study, two isolates were positive for carbapenemase production by the phenotypic MHT test, neither of which harbored carbapenem resistance genes blaOXA-48, blaKPC, and blaNDM. However, disc diffusion results showed that one isolate (KP11) was resistant to meropenem and intermediately-resistant to imipenem. The other isolate (Kp142) was intermediately-resistant to both imipenem and ertapenem. Resistance to carbapenems may be due to other mechanisms including other carbapenem resistance genes, decreased antibiotic absorption due to the lack of outer membrane porins, and the active excretion of the drug through efflux pumps or other possible mechanisms. 9 , 10 , 13

It is well known that multidrug-resistance in Enterobacteriaceae is often the result of the acquisition of resistance genes by horizontal transfer. In addition, a large number of resistance genes are present on integrons carried by plasmids and transposons. Among the antibiotic resistance integrons, the association of class 1 integron and multidrug-resistance is well known. 14 In the present study, a strong association was found between phenotypic ESBL production, β-lactamase gene carriage, and the presence of class 1 integron. We showed that 85.7% of the ESBL producing MDR isolates (including the K. oxytoca strain) harbored class I integron. Mahluji and colleagues reported that 18% of K. pneumoniae outpatient isolates were MDR and all carried class 1 integron. 37

The presence of integron in community isolates of Klebsiella could be an important factor in the spread of antibacterial resistance genes, not only between bacterial species but also among other Gram-negative enterobacterial pathogens. Interestingly, the two isolates of our study that were negative for class I integron and ESBL production (Kp 98 and Kp 137) carried blaTEM and blaSHV. Dehghan and colleagues found that 32.8% of the outpatient K. pneumoniae isolates were ESBL producers, among which CTX-M (58.6%) was predominant followed by TEM (43.1%). They also found a significant association between ESBL production and class 1 integron carriage. 38 In another study from Iran, nosocomial and outpatient MDR isolates of K. pneumoniae and K. oxytoca also carried class 1 integron. 39

Because of the lack of extensive information on molecular characteristics of the community isolates of Klebsiella, a prevalent urinary pathogen, this study was limited to outpatient isolates. Our results are limited and represent the prevalence of MDR and ESBL production in the outpatient isolates obtained from Yazd Central Laboratory and could not be applicable to other geographical regions in Iran. Further surveillance programs are needed from other regions to provide a better picture of the community spread of these multi-resistant organisms in Iran. Whether the community isolates are originated from nosocomial infections or vice versa, the presence of ESBL producing, MDR Klebsiella spp., in the community is of great concern and could have significant implications in terms of the spread of these opportunistic pathogens, indicating the need for molecular characterization of community isolates.

Conclusion

The presence of ESBL producing, MDR Klebsiella spp., in the community is of great concern and could have significant implications in terms of the spread of these opportunistic pathogens. In order to provide information on the distribution of these organisms in Iran, large-scale studies involving the characterization of the community Klebsiella spp. isolates from different parts of the country are needed.

References

  1. Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev. 1998; 11:589-603. Publisher Full Text | PubMed
  2. Ko WC, Paterson DL, Sagnimeni AJ, Hansen DS, Von Gottberg A, Mohapatra S. Community-acquired Klebsiella pneumoniae bacteremia: global differences in clinical patterns. Emerg Infect Dis. 2002; 8:160-6. Publisher Full Text | DOI | PubMed
  3. Siu LK, Yeh KM, Lin JC, Fung CP, Chang FY. Klebsiella pneumoniae liver abscess: a new invasive syndrome. Lancet Infect Dis. 2012; 12:881-7. DOI | PubMed
  4. Pitout JD, Nordmann P, Laupland KB, Poirel L. Emergence of Enterobacteriaceae producing extended-spectrum beta-lactamases (ESBLs) in the community. J Antimicrob Chemother. 2005; 56:52-9. DOI | PubMed
  5. Wener KM, Schechner V, Gold HS, Wright SB, Carmeli Y. Treatment with fluoroquinolones or with beta-lactam-beta-lactamase inhibitor combinations is a risk factor for isolation of extended-spectrum-beta-lactamase-producing Klebsiella species in hospitalized patients. Antimicrob Agents Chemother. 2010; 54:2010-6. Publisher Full Text | DOI | PubMed
  6. Paterson DL, Bonomo RA. Extended-spectrum beta-lactamases: a clinical update. Clin Microbiol Rev. 2005; 18:657-86. Publisher Full Text | DOI | PubMed
  7. Kim MH, Lee HJ, Park KS, Suh JT. Molecular characteristics of extended spectrum beta-lactamases in Escherichia coli and Klebsiella pneumoniae and the prevalence of qnr in Extended spectrum beta-lactamase isolates in a tertiary care hospital in Korea. Yonsei Med J. 2010; 51:768-74. Publisher Full Text | DOI | PubMed
  8. Dehghani AA, Rezaeian AA, KargarJahromi Z. Screening and prevalence of SHV/CTX-M/TEM β-lactamase resistance genes in Klebsiella strains isolated bacteria from urinary tract infections in pre-school-age children in Jahrom, Iran. IIOABJ. 2016; 7:82-8.
  9. Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009; 9:228-36. DOI | PubMed
  10. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007; 20:440-58. Publisher Full Text | DOI | PubMed
  11. Kim SY, Rhee JY, Shin SY, Ko KS. Characteristics of community-onset NDM-1-producing Klebsiella pneumoniae isolates. J Med Microbiol. 2014; 63:86-9. DOI | PubMed
  12. Endimiani A, Hujer AM, Perez F, Bethel CR, Hujer KM, Kroeger J. Characterization of blaKPC-containing Klebsiella pneumoniae isolates detected in different institutions in the Eastern USA. J Antimicrob Chemother. 2009; 63:427-37. Publisher Full Text | DOI | PubMed
  13. Patel G, Huprikar S, Factor SH, Jenkins SG, Calfee DP. Outcomes of carbapenem-resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect Control Hosp Epidemiol. 2008; 29:1099-106. DOI | PubMed
  14. Leverstein-van Hall MA, Box AT, Blok HE, Paauw A, Fluit AC, Verhoef J. Evidence of extensive interspecies transfer of integron-mediated antimicrobial resistance genes among multidrug-resistant Enterobacteriaceae in a clinical setting. J Infect Dis. 2002; 186:49-56. DOI | PubMed
  15. Mobarak-Qamsari M, Ashayeri-Panah M, Eftekhar F, Feizabadi MM. Integron mediated multidrug resistance in extended spectrum beta-lactamase producing clinical isolates of Klebsiella pneumoniae. Braz J Microbiol. 2013; 44:849-54. Publisher Full Text | DOI | PubMed
  16. Zhang J, Zhou K, Zheng B, Zhao L, Shen P, Ji J. High Prevalence of ESBL-Producing Klebsiella pneumoniae causing community-onset infections in China. Front Microbiol. 2016; 7:1830. Publisher Full Text | DOI | PubMed
  17. Wayne PA. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: 27th informational supplement. CLSI document M100-S20: Wayne ; 2017.
  18. Nasehi L, Shahcheraghi F, Nikbin VS, Nematzadeh S. PER, CTX-M, TEM and SHV beta-lactamases in clinical isolates of Klebsiella pneumoniae isolated from Tehran, Iran. Iran J Basic Med Sci. 2010; 13:111-8.
  19. Karah N, Poirel L, Bengtsson S, Sundqvist M, Kahlmeter G, Nordmann P. Plasmid-mediated quinolone resistance determinants qnr and aac(6’)-Ib-cr in Escherichia coli and Klebsiella spp. from Norway and Sweden. Diagn Microbiol Infect Dis. 2010; 66:425-31. DOI | PubMed
  20. Mlynarcik P, Roderova M, Kolar M. Primer Evaluation for PCR and its application for detection of carbapenemases in Enterobacteriaceae. Jundishapur J Microbiol. 2016; 9:e29314. Publisher Full Text | DOI | PubMed
  21. Khoramrooz SS, Sharifi A, Yazdanpanah M, Malek Hosseini SA, Emaneini M, Gharibpour F. High frequency of class 1 integrons in Escherichia coli isolated from patients with urinary tract infections in Yasuj, Iran. Iran Red Crescent Med J. 2016; 18:e26399. Publisher Full Text | DOI | PubMed
  22. Khanfar HS, Bindayna KM, Senok AC, Botta GA. Extended spectrum beta-lactamases (ESBL) in Escherichia coli and Klebsiella pneumoniae: trends in the hospital and community settings. J Infect Dev Ctries. 2009; 3:295-9. PubMed
  23. Lin WP, Wang JT, Chang SC, Chang FY, Fung CP, Chuang YC. The Antimicrobial susceptibility of Klebsiella pneumoniae from community settings in Taiwan, a Trend Analysis. Sci Rep. 2016; 6:36280. Publisher Full Text | DOI | PubMed
  24. Chong Y, Shimoda S, Yakushiji H, Ito Y, Miyamoto T, Kamimura T. Community spread of extended-spectrum beta-lactamase-producing Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis: a long-term study in Japan. J Med Microbiol. 2013; 62:1038-43. DOI | PubMed
  25. Bouchillon SK, Badal RE, Hoban DJ, Hawser SP. Antimicrobial susceptibility of inpatient urinary tract isolates of Gram-negative bacilli in the United States: results from the study for monitoring antimicrobial resistance trends (SMART) program: 2009-2011. Clin Ther. 2013; 35:872-7. DOI | PubMed
  26. Latifpour M, Gholipour A, Damavandi MS. Prevalence of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolates in nosocomial and community-acquired urinary tract infections. Jundishapur J Microbiol. 2016; 9:e31179. Publisher Full Text | DOI | PubMed
  27. Zaniani FR, Meshkat Z, Naderi Nasab M, Khaje-Karamadini M, Ghazvini K, Rezaee A. The Prevalence of TEM and SHV genes among extended-spectrum beta-lactamases producing Escherichia coli and Klebsiella pneumoniae. Iran J Basic Med Sci. 2012; 15:654-60. Publisher Full Text | PubMed
  28. Shakib P, Ramazanzadeh R, Taherikalani M, Nouri B. Detection of extended-spectrum beta-lactamases (ESBLs) and antibiotic susceptibility patterns in Klebsiella pneumoniae in Western, Iran. Infect Disord Drug Targets. 2018; 18:156-63. DOI | PubMed
  29. Ibrahim MA, Agban MN, Thabit AG, El-Khamissy TR, Attia AE. Prevalence of extended-spectrum β-lactamase producing Klebsiella pneumoniae by phenotypic and genotypic methods in Assiut University Hospital. The Egyptian Journal of Medical Microbiology. 2014; 23:61-70. DOI
  30. Li XM, Jang SJ, Bae IK, Park G, Kim YS, Shin JH. Frequency of extended-spectrum beta-lactamase (ESBL) and AmpC beta-lactamase genes in Escherichia coli and Klebsiella pneumoniae over a three-year period in a University Hospital in Korea. Korean J Lab Med. 2010; 30:616-23. DOI | PubMed
  31. Ranjbar R, Memariani H, Sorouri R. Molecular epidemiology of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae strains isolated from children with urinary tract infections. Arch Pediat Infect Dis. 2017; 5:e39000. DOI
  32. Mansury D, Motamedifar M, Sarvari J, Shirazi B, Khaledi A. Antibiotic susceptibility pattern and identification of extended spectrum beta-lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae from Shiraz, Iran. Iran J Microbiol. 2016; 8:55-61. Publisher Full Text | PubMed
  33. Maleki N, Tahanasab Z, Mobasherizadeh S, Rezaei A, Faghri J. Prevalence of CTX-M and TEM beta-lactamases in Klebsiella pneumoniae isolates from patients with urinary tract infection, Al-Zahra Hospital, Isfahan, Iran. Adv Biomed Res. 2018; 7:10. Publisher Full Text | DOI | PubMed
  34. van Hoek AH, Schouls L, van Santen MG, Florijn A, de Greeff SC, van Duijkeren E. Molecular characteristics of extended-spectrum cephalosporin-resistant Enterobacteriaceae from humans in the community. PLoS One. 2015; 10:e0129085. Publisher Full Text | DOI | PubMed
  35. Meir-Gruber L, Manor Y, Gefen-Halevi S, Hindiyeh MY, Mileguir F, Azar R. Population screening using sewage reveals pan-resistant bacteria in hospital and community samples. PLoS One. 2016; 11:e0164873. Publisher Full Text | DOI | PubMed
  36. Loucif L, Chelaghma W, Helis Y, Sebaa F, Baoune RD, Zaatout W. First detection of OXA-48-producing Klebsiella pneumoniae in community-acquired urinary tract infection in Algeria. J Glob Antimicrob Resist. 2018; 12:115-6. DOI | PubMed
  37. Mahluji Z, Firoozeh F, Khorshidi A, Zibaei M. The frequency of class 1 integrons in multi-drug resistant Klebsiella pneumoniae isolated from clinical samples using polymerase chain reaction assay. Scientific Journal of Kurdistan University of Medical Sciences. 2016; 21:68-78.
  38. Dehghan F, Zolghadri N, Karmostaji A. Genetic determinants of antibiotic resistance in hospital and community isolates of Klebsiella pneumoniae and Escherichia coli. Jundishapur J Microbiol. 2017; 10:e45678. DOI
  39. Salimizand H, Shahcheraghi F, Kalantar E, Badmasti F, Mousavi SF. Molecular characterization of class 1 integrons and gene cassettes in multidrug resistant (MDR) Klebsiella spp. isolated from hospitalized and outpatients in Iran, 2009. Iran J Microbiol. 2013; 5:48-55. PubMed