Iranian Journal of Medical Sciences

Document Type: Original Article

Authors

1 Department of Biotechnology and Molecular Sciences, Faculty of Medicine, North Khorasan University of Medical Sciences, Bojnurd, Iran

2 Department of Pathobiology and Laboratory Sciences, Faculty of Medicine, North Khorasan University of Medical Sciences, Bojnurd, Iran;

3 Vector-borne Diseases Research Center, North Khorasan University of Medical Sciences, Bojnurd, Iran

4 Department of Pediatrics, Faculty of Medicine, Semnan University of Medical Sciences, Semnan, Iran

Abstract

Background: To date, more than 90 Streptococcus pneumoniae (S. pneumoniae) capsular serotypes are known. The prevalence of these serotypes varies according to the geographical area and the regional vaccination program. Due to the lack of regular vaccination programs for S. pneumoniae in developing countries, serotyping of the prevalent isolates is useful in selecting the correct vaccine. The present study aimed to evaluate common serotypes of pneumococcal meningitis in Bojnurd, Iran.
Methods: All cerebrospinal fluid (CFS) samples suspected for bacterial meningitis were analyzed. The samples were collected during 2014-2018 in the Laboratory of Imam Reza Hospital (Bojnurd, Iran). Due to the high rate of false-negative cultures, polymerase chain reaction (PCR) was used for the detection of lytA and psaA genes of S. pneumoniae. In addition, the modified Marimon’s PCR method was used for serotyping the bacteria. The data were analyzed using Pearson’s Chi-square test.
Results: Out of the 901 CSF samples, 106 cases tested positive for S. pneumoniae using the PCR method, while only 92 cases tested positive using the conventional methods. Based on the Marimon’s PCR method, serotypes 23F, 19F, 19A, 1, 14, and serogroup 6A/B were the most common types. Serogroups 18C, 15A/F, 15B/C, 9A/V, 7A/F, 11A/D/F, and 22A/F were also detected in isolates. Note that 2.8% of the samples were non-typable (NT).
Conclusion: The results showed that only 13 serotypes were responsible for all meningitis cases. Pneumococcal capsular vaccine-13 (PCV-13) is the preferred choice against common serotypes of S. pneumoniae in northeast Iran.
The abstract was presented in Iran’s 19th International Congress of Microbiology, as a poster and published in the congress abstracts book.

Keywords

What’s Known

Streptococcus pneumoniae is one of the major causative agents of meningitis in children. pneumococcal conjugate vaccine is one of the best methods to prevent pneumococcal disease. Pneumococcal capsular serotypes can vary in different geographical areas.

What’s New

The first attempt to evaluate the most common capsular serotypes in northeast Iran. Considering common capsular serotypes in Bojnurd (Iran), PCV-13 vaccine is the suitable choice for a vaccination program.

Introduction

Streptococcus pneumoniae (S. pneumoniae) is a Gram-positive coccus that can colonize the nasopharyngeal area without major clinical symptoms. Clinical manifestation of the bacteria ranges from otitis media and sinusitis to bacteremia, invasive pneumonia, and meningitis. 1 , 2S. pneumoniae causes more than 14 million cases of invasive infections and approximately one million deaths annually among children in developing and underdeveloped countries. During 1999-2010, in the Asian-Pacific region, the incidence of pneumococcal disease among children aged under two years was about 150 cases per 100,000. 3

Meningitis is defined as the inflammation of meninges surrounding the brain and spinal cord. Infectious agents that cause bacterial meningitis are S. pneumoniae, Neisseria meningitidis, and Hemophilus influenzae. Of these, S. pneumoniae is the most common agent. It has various virulence factors such as streptolysin-O, IgA protease, and polysaccharide capsule. The bacterium has more than 90 capsular serotypes, but only a limited number is related to acute pneumococcal meningitis. 4

The mortality rate due to meningitis among children and adults is 25-73% and 20-30%, respectively, and the survivors often suffer from neurological complications and sequelae. 4 The adverse effect depends on the patient’s medical condition such as the underlying chronic disease, immune system, nutrition, etc. 5 , 6 Considering the high morbidity and mortality rates associated with pneumococcal infections, it is important to implement life-saving programs for the prevention, timely diagnosis, and treatment of pneumococcal diseases. As part of a national vaccination program, two types of vaccines are currently used in developed countries, namely pneumococcal capsular vaccine-10 (PCV-10) and pneumococcal capsular vaccine-13 (PCV-13). These vaccines contain serotypes [1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F] and [1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F], respectively.7 The production of PCV-7, the previous type of PCV vaccine, has already been stopped.

In some developing countries, such as Iran, pneumococcal vaccination is not included in the national vaccination program. Therefore, data on serotypes causing invasive pneumococcal infections are not readily available since vaccination is carried out locally in Iranian public and private hospitals. 4 , 8 Patients with suspected meningitis are typically viewed as emergency cases and physicians immediately proceed with empirical anti-microbial therapy and obtain cerebrospinal fluid (CSF) for laboratory evaluations. In some cases, the CSF culture could be negative while other tests (e.g. serological and molecular diagnostic) could be positive. Consequently, methods such as polymerase chain reaction (PCR) and multiplex PCR are also used. 9

Since the prevalence of serotypes causing invasive pneumococcal infections varies in different geographical areas, we focused our study on patients suspected of meningitis in Bojnurd, Iran. Using the molecular method, we evaluated CSF samples for pneumococcal serotypes to recommend a regional vaccination program.

Materials and Methods

An observational and descriptive study of CSF samples from patients with suspected meningitis was conducted in the Laboratory of Imam Reza Hospital, Bojnurd, Iran. The samples were collected during 2014-2018 from children aged <5 years with an increased level of C-reactive protein (CRP) or with fever and CSF leukocytosis. The samples were evaluated for S. pneumoniae using conventional methods, including CSF sediment gram staining, microscopic evaluation, and culture. The PCR assay was performed using lytA (N-acetylmuramoyl-L-alanine amidase) and psaA (pneumococcal surface adhesin A) as marker genes. In addition, capsular serotypes were determined using the modified Marimon’s multiplex PCR method for wzy, wchE, and wciN beta genes.

The inclusion criteria were different physical examinations for children <12 months and for those between 12 months and 5 years old, such as bulging fontanel, nuchal rigidity, and positive Brudziński signs. The general inclusion criteria were increased levels of CRP, CSF leukocytosis, CSF protein; reduced level of CSF glucose; and physical signs of fever, neck stiffness, vomiting, headache, etc. The exclusion criterion was a previous PCV vaccination. The data were analyzed with Pearson’s Chi-square test using SPSS software (version 22.0). P<0.05 was considered statistically significant.

The study was approved by the Ethics Committee of North Khorasan University of Medical Sciences, Bojnurd, Iran (code: 95/P/970). Written informed consent was obtained from the parents of the children.

Genomic DNA Extraction

Total genomic DNA of the CSF samples was extracted using QIAamp® DNA Blood mini kit (QIAGEN, Germany). In accordance with the manufacturer’s instruction, lysozyme at the concentration of 20 units/ml (SinaClon, Iran) was added to the lysis buffer. To obtain better results, based on a previous study, 10 the CSF samples were centrifuged at 8,000 rpm for 3 minutes and then used as the precipitants for DNA extraction. 10

PCR Assay

The PCR assay was performed using the TAKARA PCR thermal cycler Gradient TP600 (TAKARA, Japan). For all PCR reactions, EmeraldAmp® MAX PCR Master Mix 2X (Takara, Japan) in a volume of 50 µl was used.

PCR Assay for Detection of S. pneumoniae

The lytA and psaA genes were selected as marker genes for the detection of S. pneumoniae. PCR was performed with the following sequences: primary denaturation at 94 °C for 5 minutes, 35 cycles of amplification (denaturation at 94 °C for 30 seconds, annealing at 58 °C for 30 seconds, extension at 72 °C for 30 seconds), and a final extension at 72 °C for 7 minutes. ATCC® 33400 reference strain was used for PCR optimization and to determine the limit of detection (LOD) of the triplex PCR method. The third set of primers was added to the reaction as the internal control for preventing false-negative results. Specific primers were used as the control for the recognition of the human beta-globin gene. The list of primer sequences is described in table 1.

To assess the LOD, 10-fold serial dilutions (equivalent to 107-101 copies) of a pneumococcal reference strain ATCC® 33400 were prepared using tested sterile CSF as a solvent (due to the presence of human cells containing the beta-globin gene as the internal control) and the extracted DNA was tested by triplex PCR protocol. In positive reactions, the bands 268 (internal control), 187 (lytA), and 114 bp (psaA) were observed (figure 1). In negative reactions, only the internal control band (268 bp) was observed (table 2). The primers were evaluated using the software packages AlleleID 6.0 (Biosoft International, Palo Alto, CA, USA) and Oligo 6.0 (Life Science Software Resource, Minnesota, USA). The reactions without any PCR product bands were false-negative and the results were not reliable (table 2). As shown in figure 1 and table 3, the mean LOD of the reaction after triplicate testing was between 101-102 colony-forming unit (CFU).

Primer Sequence size Reference
lytA 1 forward 5’-CCATTATCAACAGGTCCTACC-3’ 187 bp3 Present study
lytA reverse 5’-TAAGAACAGATTTGCCTCAAG-3’
PsaA 2 forward 5’-GCCCTAATAAATTGGAGGATCTAATGA-3’ 114 bp Jourdain et al.12
PsaA reverse 5’-GACCAGAAGTTGTATCTTTTTTTCCG-3’
Beta-globin forward 5’-GAAGAGCCAAGGACAGGTAC-3’ 268 bp Present study
Beta-globin reverse 5’-CAACTTCATCCACGTTCACC-3’
Table 1. Primer sequences for detection of S. pneumoniae

Figure 1. Agarose gel electrophoresis of triplex PCR on standard samples. The 268 bp, 187 bp, and 114 bp bands belong to beta-globin, lytA, psaA genes, respectively. Lanes, 1: 100 bp ladder; 2: 107 copy; 3: 106 copy; 4: 105 copy; 5: 104 copy; 6: 103 copy; 7: 102 copy; 8: 101 copy of S. pneumoniae genome

Interpretation Beta-globin: 268 bp lytA: 187 bp psaA: 114 bp
Unacceptable - - -
S. pneumoniae - + - -
S. pneumoniae + + + +
Table 2. Interpretation of S. pneumoniae detection PCR results
Number Standard CFU Result
1 S1 107 +
2 S2 106 +
3 S3 105 +
4 S4 104 +
5 S5 103 +
6 S6 102 +
7 S7 101 -
Table 3. Determination of LOD using the PCR method

The PCR was also performed on 51 clinical isolates of S. pneumoniae and all reactions tested positive for lytA and psaA genes; indicating 100% sensitivity. For the specificity evaluation, PCR was performed using the extracted DNA from Haemophilus influenzae (ATCC51907), Neisseria meningitidis (ATCC13077), Staphylococcus aureus (ATCC19323), Streptococcus viridance (ATCC6249), Enterococcus fecalis (ATCC29212), Enterococcus faecium (ATCC700221), Escherichia coli (ATCC25922), Streptococcus agalactiae (ATCC13813), Listeria monocytogenes (ATCC19115), Pseudomonas aeruginosa (ATCC10145), and Mycobacterium tuberculosis (ATCC25177). All reactions were negative.

Multiplex PCR for Determination of Capsular Serotypes

The primers used for the amplification of various capsular types (wzy, wchE, and wciN genes) are listed in table 4. Marimon’s method was modified and adapted to the conventional PCR and agarose gel electrophoresis settings. 9 Originally, Marimon designed 55 sets of primers for evaluation with a capillary electrophoresis system. However, in the absence of such a system, due to the similar size of the PCR products of different primer pairs in the Marimon’s method, we performed the evaluation with the conventional PCR and electrophoresis. The 55 pairs of primers were grouped into nine separate multiplex reactions based on the difference in their PCR product size. The optimum difference in size for detection in agarose gel electrophoresis was about 100 bp. In some cases, when grouping based on product size was not possible, the PCR products were evaluated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The PCR thermal cycling condition was 15 minutes at 95 ºC; 35 cycles of 60 seconds at 95 ºC, 60 seconds at 58 ºC, and 60 seconds at 72 ºC; and a final extension step of 10 minutes at 72 ºC.

Reaction Serotype Size (bp) Forward Reverse
1 14 84 CCGTCTTTTTGTATGGTGCTATG TGAACAGCCAATCCATCAATCAG
22A, 22F 181 ACGTATAGGACGTTTCTCAATCC ATCCCGAAACCAAATTGCTATCC
33C 278 CGGCAGGTATAAGTATTATCGG CCTACACCTCTTATAAACGTTGG
35F, 47F 375 TTGCTACAGTTTTGATGTATCTCC AGAATCCGTTTCATCATACAGCC
6C, 6D 473 GTCGTGTAAAGTAGTATACAATCC ATAATCCTCTGGATTATCCACCC
24A, 24B, 24F 569 TCATGCTTATGTTATGTGTTACGG GTGAGAGCTATATTTAGAACATGG
23B 650 TTGCATATGGATTTAATGGTGGG ACCATTGCTGATAGAAGTAGAGG
2 8 94 ATTAGCTGCATACGCAAGAACC ATTAGCTGCATACGCAAGAACC
3 191 AGAAATGCTATCCGCGTTGGG TTGTCACGAGATTACGCTCAGG
20 292 TATTGTTCCGAAAAAAGAGTGGG TACTCAAAGATTGTGTGGTACGG
11B, 11C 392 TAGAAATCGCAAGATAGCCTTCC CTGATTATGAGCATAGTTGATCC
7A, 7F 491 TTGACTGCAAGTGTTTCAATGGG AAAGCACAAAATATTGGAACGAGG
28A, 28F 578 AGGTAGACTACCAATTTCAATTCC TACACCTGCTAATATCAATGTTCC
3 7B, 7C, 40 101 TTATTTTTTAGAAACATTAAAACTC AACAATCATCTCTATTCGACC
15B, 15C 201 CGGATGATTGTAGCGTTTTATCC ACTGTAGATTGTGTTCTGATTCC
31 301 TTTCAAGGATATGATAGTGGTGG TAGCATTACAGATGTCACTAAGG
17F 402 TCTTGTCAAATACATACTTACCCC GTAGTCTCGCATTTCTATCATCC
16A 501 GTTATGATAATGGTAACGCCTCC CAGCCAATAAGTCATATACGCC
15A, 15F 598 ATGAGAGGAAGATATATACTGGG AAATAAGTTGTCCCATAGGAAGG
4 9L, 9N 111 CACTGTTGGCTATGTTAGCCTC CTCTCCACGTGGCCAATATAC
6A, 6B, 6C, 6D 211 GAAGTAGAAAATCGTGTAAGTGG TCCAACAACTAACCTTATAAGGG
23A 314 CTAGGTTCGTATCTCTTTGCGG TACCAAATGGGTAATGGAGGGG
41A, 41F 413 AGTTACTGGCCCTTTCTTATTCC AGGTAAAAAGTCATATCCATTCCC
19F 523 TGTTCTTAGTAATGGATATACGGG AAAACTTCACCAGGATCTAATGG
17A 615 TTTACCCAAGAATGGTTTCTAGG AGCATAACAGTTTGCGCTATTGG
5 21 122 TTATGCTGGTTTAAATATCGCTCC TAACAAATATGCCAAAACGTAGCC
34 130 TGTAAGAGGAGATTATTTTCACCC GTCACAATAAAAACTGTACCTCC
25A, 25F, 38 140 CAACACAATGTCTTATTGCAGCC AACGCACCCCAAAATAACTTTCC
27 240 AATGCCGACGATTAATGCAGCC CTAGCCATGCTGGATATTTCCC
19B, 19C 338 TCAGTACGAATAGATGGAACACC CCCAGTATCTAAATCCTAATCCC
4 433 ATTCAGAGGCAGCTAGTTCAGG CAGAAGCTACTGTTAGGCTGG
48 532 CCCTTTGATAGCTATAGTATCGG CCCTGGAATAGAAGTTTTCTAGG
12A, 12B, 12F, 44, 46 627 CCTTTCTGATTCGTCCAGTTCC AGTTGAACCAACTCCCCATCC
6 10A, 10B, 0C, 10F 151 CRATGAGGCTATATGTTGGAATAG GTATTGAACYCATAGATAACAGAG
29 251 TGTGGCAAAAATTTCTTTAGCGG ATATACCCAGTAAACAGACAAGG
11A, 11D, 11F 348 GGACATGTTCAGGTGATTTCCC TGCGCCAAATTTGGTATCGACC
5 443 TTATCTATTTTATCGCAGACTCCC CTGCCGATAAAAAGATAGATGCC
39 544 TATGAGGTATCATTTAGCAGGGG ATCATCGAAATGGCAACTAAAGG
33B, 33D 640 ACAACAGCAATGTTGTTGTTACTC GAGAAGTAAGAGTTTTGTCATCC
7 43 160 GGAATAGTTTAGGATTTGTACACC TAGAGTCTGCTAACTGTAATATCC
23F 260 TTCACAAGTGATAGTGAACTTGG TATTAGCTTTATCGGTAAGGTGG
32A, 32F 357 CTTACAATGAGACGCTATTTTCC GTTATTACCATTGAATTCGTTCCC
33A, 33F, 37 453 ATGTTAGATTAGATGGTTTGCTGG ATTCAACACATAAACCGTTGGGG
1 555 TTTGCTAGATGGTGAGTTTGTATC TTTAGAAGCTGCATTGTACTACTC
36 230 TTCCGGATCTATTCAATTTCCCC CAATAACAGCCTCCGTTTTACC
2 383 GTTCAATATTTCTCCACTACACC CTAAGAGTTCCAATACGTTGACC
35B 483 CATTAGTGTTGCTATGTTGTTCC GATTAGATAAATAAATACGCCCCC
16F 606 ACTGCTTGCATATTAGCTTTATGG TGATAGAGTGACAGAACAATTGG
8 9A, 9V 172 GATCAATGGCAACTATATTTACCC GATTCACTGTCTGACTTTGAACC
19A 269 ATTGGAGTAGCTGAGGTTTTTGG TATCCAATTTAAAACCAGCACGG
35A, 35C, 42 367 TCGTTCACCTACTTTATTAATGCC AATAATTCCTAATACCATCTGCCC
45 463 CAGATTGGTTTTCACATCACTCC ACATAACACGACTTTTAGTGACC
9 18A, 18B, 18C, 18F 220 AGTCTTACTAGACGTAATGAACC AAGATAAATTGACTAAGTCCTCCC
13 328 TTAACAGGTAGATTACGACTTGG ATATCCCAAAAACAAAATCGCTGG
47A 423 AATACATTGTACGTCTTTAACCCC CGAAGAATTAAACCCACATAACC
Table 4. Primer sequences for serotyping of S. pneumoniae

Results

Out of the 901 CSF sample, 92 cases tested positive for S. pneumoniae in culture and 106 cases tested positive for lytA and psaA genes using the molecular detection method. It should be noted that all the 92 culture-positive samples also tested positive in PCR. Of the 106 (11.8%) positive samples, 50 (47.2%) and 56 (52.8%) isolates were from female and male patients, respectively. There was no significant correlation between sex and S. pneumoniae isolation (P=0.92). Based on the primer pair combinations in table 1, all positive samples were evaluated for capsular serotypes using the modified Marimon’s multiplex PCR method. As shown in figure 2, the types 23F, 19F, 19A, 1, 14, and group six were the most common serotypes and groups in our samples. It should be noted that 2.8% of the samples were Non-typable (NT). The results for capsular serotypes and their distribution are presented in figure 2 and table 5.

Figure 2. Serotype distribution among S. pneumoniae strains.

2014-2015n (%) 2015-2016n (%) 2016-2017n (%) 2017-2018n (%) Totaln (%)
Number of S. pneumonian [+, %] 160 [16, 10] 163 [19, 11.7] 278 [29, 10.4] 300 [42, 14] 901
S. Pneumoniae +a 16 (15.1) 19 (17.9) 29 (27.4) 42 (39.6) 106 (11.8)
Womenb 10 (62.5) 8 (42.1) 16 (55.2) 16 (38.1) 50 (47.2)
Menb 6 (37.5) 11 (57.9) 13 (44.8) 26 (61.9) 56 (52.8)
Serotypec 23F 3 (15) 5 (25) 4 (20) 8 (40) 20 (18.9)
19A 2 (15.4) 3 (23.1) 4 (30.8) 4 (30.8) 13 (12.3)
19F 4 (23.5) 3 (17.6) 5 (29.4) 5 (29.4) 17 (16)
18C 0 1 (25) 1 (25) 2 (50) 4 (3.8)
6A/B 3 (21.4) 2 (14.3) 4 (28.6) 5 (35.7) 14 (13.2)
15B/C 0 0 1 (50) 1 (50) 2 (1.9)
14 1 (11.1) 2 (22.2) 2 (22.2) 4 (44.5) 9 (8.5)
9A/V 1 (20) 1 (20) 1 (20) 2 (40) 5 (4.7)
15A/F 0 0 0 1 (100) 1 (0.9)
7A/F 0 0 0 2 (100) 2 (1.0)
1 2 (18.2) 1(9.1) 4 (36.4) 4 (36.4) 11 (10.4)
11A/D/F 0 0 2 (66.6) 1 (33.3) 3 (2.8)
22A/F 0 0 0 2 (100) 2 (1.9)
NT 0 1 (33.3) 1 (33.3) 1 (33.3) 3 (2.8)
Table 5. Serotype distribution among S. pneumoniae strains in different years

Discussion

Serotypes 23F, 19F, 1, 14, 19A, and serogroup 6 were the most common types in Bojnurd, Iran. PCV13 had the optimal coverage for children aged ≤5 years in this area. The Quellung reaction (Neufeld test) is the accepted gold standard method for S. pneumoniae serotyping. However, a number of factors (e.g., costs, the need for operational expertise, potential false-negative cultures especially in meningitis cases) hindered its use in clinical laboratory settings. 11 Molecular assays have recently been developed to identify the invasive pneumococcal disease (IPD) associated with serotype distribution. 9 , 12 Consequently, we used the modified Marimon’s molecular method for serotyping S. pneumoniae. A limited number of capsular serotypes were related to most of the IPDs. 13 In the present study, we found 13 serotypes, which were responsible for all meningitis cases. Note that 2.8% of the isolates were NT.

During the last two years, the prevalence of some serotypes (9A/V, 15A/F, 7A/F, 1, 11A/D/F and 22A/F) has increased in Bojnurd, Iran. Studies in the USA, UK, and Brazil have reported that only a few pneumococcal serotypes were related to the colonization and invasive diseases, 14 - 16 whereas a wide variety of such serotypes were identified in Asia. 17 , 18 The serotypes 23F, 14, 19F, and 6B were predominant in East and Southeast Asia prior to the PCV vaccination. 3 Several studies have reported that serotypes 1, 4, 6A/B, 7F, 9V, 14, 15B/C, 18C, 19F, 19A, and 23F account for more than 80% of the IPD in children, especially in developing countries without any routine pneumococcal vaccination programs. 19 - 22 In the absence of such programs in Iran, we managed to identify the presence of serotypes 23F, 19A, 19F, 18C, 14, 1, and serogroups 6A/B, 15B/C, 9A/V, 15A/F, 7A/F, 11A/D/F, and 22A/F. In line with other studies, 1 , 4 , 23 - 26 we found that the most prevalent serotypes in meningitis cases were 23F, 19A, 19F and 6A/B, which could be controlled with the PCV-13 vaccine. In contrast, Talebi and colleagues reported that the most common serotypes in pneumococcal isolates were 14 and 3, followed by 23F and 19F. 27

Some researchers believe that the common serotypes in infants are different from those found in adults. A previous study reported that the serotypes 6 and 19 were common in IPD related isolates and the 23-valent vaccine was best for adults. 28 Moreover, in another study, they reported serotype 6 was most prevalent in adults, but serotype 19 in infants. 29 Dashti and colleagues reported that the most prevalent serotypes were 19, 6, 14, 17, 20, 23, and 21 in nasopharyngeal carriers under 10 years old in Tehran (Iran). 30 Another study reported that four serotypes of 19A, 6, 3, and 23F were common in both the carrier and clinical samples at a rate of at least 91%. 13 Gharailoo and colleagues reported that the serotypes 6A/B, 19A, 19F, and 23F were the common types of nasopharyngeal carriers, 31 whereas another study reported that the most common serotypes in nasopharyngeal carrier children were 19F, 6A/B, 15A, 11, 23F, 1, 19A, and 35B. 32 Based on the above-mentioned studies, we deduced that the source of meningitis related to pneumococcal serotypes was the nasopharyngeal area. Overall, the data showed that serotypes 6A/B, 14, 18C, 19F, 19A, and 23F were the most prevalent serotypes in Asia, especially in non-immunized areas.

We found that PCV-13 vaccine is the best candidate against common serotypes of meningitis-related S. pneumoniae strains. This vaccine is readily available in Iran and covers 77.13% of the most common serotypes in our region, especially 23F, 19A, 19F, and 6A/B. On the other hand, PCV-10 vaccine covers 65.06% of the serotypes but excludes the two major serotypes 19A and 6A. None of these vaccines could cover serotypes 22, 7, 15A/F, 15B/C, and 11. The present study was the first attempt to identify the distribution of serotypes in Bojnurd. Serotyping on more specimens is recommended to determine the extent of their coverage and evaluate the effectiveness of the vaccine.

Conclusion

The high pathogenicity of S. pneumoniae in different age groups and the increasing antimicrobial resistance are alarming. The management of this pathogen is essential to protect lives and to reduce therapeutic treatment costs. PCV-13 vaccine is the preferred choice in northeast Iran. More research on serotypes in different geographical regions allows the design of a nationwide vaccination program. Further studies on capsular serotyping, antimicrobial susceptibility testing, and molecular epidemiology should provide a better understanding of common pneumococcal types and allow choosing optimal therapeutic strategies in Iran.

References

  1. Houri H, Tabatabaei SR, Saee Y, Fallah F, Rahbar M, Karimi A. Distribution of capsular types and drug resistance patterns of invasive pediatric Streptococcus pneumoniae isolates in Teheran, Iran. Int J Infect Dis. 2017; 57:21-6. DOI | PubMed
  2. Zhao C, Li Z, Zhang F, Zhang X, Ji P, Zeng J. Serotype distribution and antibiotic resistance of Streptococcus pneumoniae isolates from 17 Chinese cities from 2011 to 2016. BMC Infect Dis. 2017; 17:804. Publisher Full Text | DOI | PubMed
  3. Tai SS. Streptococcus pneumoniae Serotype Distribution and Pneumococcal Conjugate Vaccine Serotype Coverage among Pediatric Patients in East and Southeast Asia, 2000-2014: a Pooled Data Analysis. Vaccines (Basel). 2016; 4Publisher Full Text | DOI | PubMed
  4. Attarpour-Yazdi MM, Ghamarian A, Mousaviehzadeh M, Davoudi N. Identification of the serotypes of bacterial meningitis agents; implication for vaccine usage. Iran J Microbiol. 2014; 6:211-8. Publisher Full Text | PubMed
  5. Boisier P, Mainassara HB, Sidikou F, Djibo S, Kairo KK, Chanteau S. Case-fatality ratio of bacterial meningitis in the African meningitis belt: we can do better. Vaccine. 2007; 25:A24-9. DOI | PubMed
  6. Shields B. Prevnar (heptavalent pneumococcal conjugate vaccine): disease prevention in infants and children. J Pediatr Health Care. 2001; 15:203-8. DOI | PubMed
  7. Miller E, Andrews NJ, Waight PA, Slack MP, George RC. Effectiveness of the new serotypes in the 13-valent pneumococcal conjugate vaccine. Vaccine. 2011; 29:9127-31. DOI | PubMed
  8. Houri H, Pormohammad A, Riahi SM, Nasiri MJ, Fallah F, Dabiri H. Acute bacterial meningitis in Iran: Systematic review and meta-analysis. PLoS One. 2017; 12:e0169617. Publisher Full Text | DOI | PubMed
  9. Marimon JM, Ercibengoa M, Santacatterina E, Alonso M, Perez-Trallero E. Single-Step Multiplex PCR Assay for Determining 92 Pneumococcal Serotypes. J Clin Microbiol. 2016; 54:2197-200. Publisher Full Text | DOI | PubMed
  10. Havaei SA, Azimian A, Fazeli H, Naderi M, Ghazvini K, Samiee SM. Isolation of Asian endemic and livestock associated clones of methicillin resistant Staphylococcus aureus from ocular samples in Northeastern Iran. Iran J Microbiol. 2013; 5:227-32. Publisher Full Text | PubMed
  11. Jauneikaite E, Tocheva AS, Jefferies JM, Gladstone RA, Faust SN, Christodoulides M. Current methods for capsular typing of Streptococcus pneumoniae. J Microbiol Methods. 2015; 113:41-9. DOI | PubMed
  12. Jourdain S, Dreze PA, Vandeven J, Verhaegen J, Van Melderen L, Smeesters PR. Sequential multiplex PCR assay for determining capsular serotypes of colonizing S. pneumoniae. BMC Infect Dis. 2011; 11:100. Publisher Full Text | DOI | PubMed
  13. Mousavi SF, Nobari S, Rahmati Ghezelgeh F, Lyriai H, Jalali P, Shahcheraghi F. Serotyping of Streptococcus pneumoniae isolated from Tehran by Multiplex PCR: Are serotypes of clinical and carrier isolates identical?. Iran J Microbiol. 2013; 5:220-6. Publisher Full Text | PubMed
  14. Laval CB, de Andrade AL, Pimenta FC, de Andrade JG, de Oliveira RM, Silva SA. Serotypes of carriage and invasive isolates of Streptococcus pneumoniae in Brazilian children in the era of pneumococcal vaccines. Clin Microbiol Infect. 2006; 12:50-5. DOI | PubMed
  15. Brueggemann AB, Griffiths DT, Meats E, Peto T, Crook DW, Spratt BG. Clonal relationships between invasive and carriage Streptococcus pneumoniae and serotype- and clone-specific differences in invasive disease potential. J Infect Dis. 2003; 187:1424-32. DOI | PubMed
  16. Whitney CG, Farley MM, Hadler J, Harrison LH, Lexau C, Reingold A. Increasing prevalence of multidrug-resistant Streptococcus pneumoniae in the United States. N Engl J Med. 2000; 343:1917-24. DOI | PubMed
  17. Saha SK, Baqui AH, Darmstadt GL, Ruhulamin M, Hanif M, El Arifeen S. Comparison of antibiotic resistance and serotype composition of carriage and invasive pneumococci among Bangladeshi children: implications for treatment policy and vaccine formulation. J Clin Microbiol. 2003; 41:5582-7. Publisher Full Text | DOI | PubMed
  18. Coles CL, Kanungo R, Rahmathullah L, Thulasiraj RD, Katz J, Santosham M. Pneumococcal nasopharyngeal colonization in young South Indian infants. Pediatr Infect Dis J. 2001; 20:289-95. PubMed
  19. Song JY, Nahm MH, Moseley MA. Clinical implications of pneumococcal serotypes: invasive disease potential, clinical presentations, and antibiotic resistance. J Korean Med Sci. 2013; 28:4-15. Publisher Full Text | DOI | PubMed
  20. Zancolli M, Canepa P, Ceravolo A, Parodi V, Ansaldi F. Determinants of invasiveness and ability to cause invasive pneumococcal disease, pneumonia and acute otitis media of different serotypes of Streptococcus pneumoniae. J Prev Med Hyg. 2011; 52:47-54. PubMed
  21. Nuorti JP, Whitney CG, Centers for Disease Control and Prevention Prevention of pneumococcal disease among infants and children - use of 13-valent pneumococcal conjugate vaccine and 23-valent pneumococcal polysaccharide vaccine - recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recomm Rep. 2010; 59:1-18. PubMed
  22. Hausdorff WP, Feikin DR, Klugman KP. Epidemiological differences among pneumococcal serotypes. Lancet Infect Dis. 2005; 5:83-93. DOI | PubMed
  23. Zhang YJ, Chen YS, Wang ZW, Li YQ, Wang DX, Shang Y. Serological and molecular capsular typing, antibiotic susceptibility and multilocus sequence typing of Streptococcus pneumoniae isolates from invasive and non-invasive infections. Chin Med J (Engl). 2013; 126:2296-303. PubMed
  24. Mehrabi Tavana A, Ataee RA. Invasive Pneumococcal Disease (IPD) Serotype Frequency in Iranian Patients. Iran Red Crescent Med J. 2013; 15:740-2. Publisher Full Text | DOI | PubMed
  25. Percin D, Ay Altintop Y, Sumerkan B. Ten-year surveillance of invasive Streptococcus pneumoniae isolates in central Turkey prior to the introduction of a conjugate vaccine. J Infect Dev Ctries. 2010; 4:560-5. PubMed
  26. Sakata H. Invasive pneumococcal diseases in children in Hokkaido, Japan from April 2000, to March 2015. J Infect Chemother. 2016; 22:24-6. DOI | PubMed
  27. Talebi M, Azadegan A, Sadeghi J, Ahmadi A, Ghanei M, Katouli M. Determination of Characteristics of Erythromycin Resistant Streptococcus pneumoniae with Preferred PCV Usage in Iran. PLoS One. 2016; 11:e0167803. Publisher Full Text | DOI | PubMed
  28. Tavana A. Invasive pneumococcal disease (IPD) in Iranian patients and it’s serotyping distribution in order to prevent the infection with suitable vaccine. Annals of Tropical Medicine and Public Health. 2013; 6:684-5. DOI
  29. Tavana AM, Ataee R, Gerami M, Gooya M, Karami A, Ranjbar R. A study investigating the Streptococcus Pneumoniae pattern among Iranian patients. Arch Pharm Pract. 2012; 3:122-8.
  30. Sanaei Dashti A, Abdinia B, Karimi A. Nasopharyngeal carrier rate of Streptococcus pneumoniae in children: serotype distribution and antimicrobial resistance. Arch Iran Med. 2012; 15:500-3. PubMed
  31. Gharailoo Z, Mousavi SF, Halvani N, Feizabadi MM. Antimicrobial Resistant Pattern and Capsular Typing of Streptococcus Pneumoniae Isolated from Children in Sistan -Baluchestan. Maedica (Buchar). 2016; 11:203-7. Publisher Full Text | PubMed
  32. Mirzaei Ghazikalayeh H, Moniri R, Moosavi SG, Rezaei M, Yasini M, Valipour M. Serotyping, Antibiotic Susceptibility and Related Risk Factors Aspects of Nasopharyngeal Carriage of Streptococcus pneumoniae in Healthy School Students. Iran J Public Health. 2014; 43:1284-90. Publisher Full Text | PubMed