Iranian Journal of Medical Sciences

Document Type : Original Article(s)

Authors

1 Department of Urology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

2 Department of Immunology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

3 Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

4 Department of Urology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran;

Abstract

Background: Regulatory T cells (Tregs) play a key role in the progression of tumors. These cells express forkhead box P3 (FOXP3) and cytotoxic T-lymphocyte-associated protein 4 (CTLA4), which are the potential targets for cancer immunotherapy. The present study aimed to evaluate FOXP3 and CTLA4 transcripts in patients with bladder cancer (BC) compared with healthy individuals.
Methods: Transcripts of CTLA4 and FOXP3 genes in the peripheral blood mononuclear cells (PBMCs) of 50 patients with histologically confirmed BC and 50 healthy individuals were assessed at the Institute for Cancer Research, Shiraz University of Medical Sciences (Shiraz, Iran) during 2014-2016. RNA was extracted from PBMCs, then cDNA was synthesized and subjected to quantitative real-time PCR (qRT-PCR) using appropriate primers. Statistical analysis was performed using SPSS software (version 21.0).
Results: Significantly higher amounts of CTLA4 and FOXP3 gene transcripts were found in the peripheral blood of BC patients compared with healthy individuals. The expression of both genes was significantly higher in patients with non-invasive and grade I/II BC. The median of CTLA4 and FOXP3 transcript expressions was 3.74 and 5.39, respectively, in non-invasive BC patients, which was significant compared with the control group (P=0.0016 and P=0.009, respectively). The median of target gene mRNA expression in grade I/II BC patients was 2.9 for CTLA4 and 6.61 for FOXP3, which was significant compared with the controls (P=0.013 and P=0.0037, respectively).
Conclusion: This study highlights the functional activity of Tregs in early stages of bladder cancer and showed the importance of CTLA4 and FOXP3, when it comes to screening BC.

Keywords

What’s Known

Regulatory T cells play a key role in lymph nodes and tissues of patients with different types of cancer such as bladder cancer for tumor progression.

What’s New

The significance of regulatory T cells in the peripheral blood of bladder cancer patients is demonstrated. Our findings provide valuable data, which contribute to the development of new strategies for the detection of bladder cancer.

Introduction

Bladder cancer (BC) is the most common urologic malignancy. It has a higher incidence in men and ranks among the top ten most prevalent cancer types worldwide. 1 , 2 BC is mostly affected by various environmental factors (smoking, occupational exposure to aromatic amines and industrial chemicals) and several lifestyle factors such as obesity. 3 Chronic inflammation plays a prominent role in developing BC and tumorigenesis through DNA damage, angiogenesis stimulation, and cell proliferation. 1 , 4 Although T-cell proliferation provides inflammatory responses, it should be regulated and controlled to prevent damaging inflamed tissues and autoimmune diseases. 5 , 6

Different subsets of T cells including T helper (Th) 1, Th2, Th17, and regulatory T-cell (Treg) have differential effects on immune responses against tumor cells and tumor immune evasion. CD4+CD25+FOXP3+T cells, also known as regulatory T cells (Tregs), play inhibitory roles in the immune system. 7 In the context of suppressing immune responses of solid tumors, the presence of Tregs has been shown to be associated with negative prognosis in a variety of malignancies including lung and breast cancer and melanoma. In contrast, tumor-infiltrating Tregs may correlate with a favorable prognosis in certain tumors such as gastric and colorectal cancer by controlling inflammation. 8 The frequency of Tregs in peripheral blood was introduced as a new and important prognostic marker in BC. 9 High expression of forkhead box P3 (FOXP3) in Tregs was seen earlier in patients with BC, which indicates the presence of immune suppression. 10 Basic inhibitory mechanism of Tregs is applied by FOXP3 to upregulate cytotoxic T-lymphocyte associated protein 4 (CTLA4) gene. 7 CTLA4 is an inhibitory molecule expressed in many T cells and mostly in a large number of FOXP3+Tregs.

Delayed diagnosis of BC is usually due to the late onset of unspecific symptoms. This in turn may increase the risk of recurrence and make it more difficult to find a desirable therapeutic method for patients with advanced-stage BC. Moreover, delayed diagnosis and the subsequent progression of cancer poses a huge challenge to healthcare systems and imposes a considerable financial burden on the community. 11 - 15 Although the cancer SEEK test has an acceptable sensitivity to detect solid tumors such as ovary, liver, stomach, pancreas, and esophagus cancer, it is not applicable to BC. 16 Therefore, it is important to identify other factors, which allow BC screening. The present study aimed to determine the association between CTLA4 and FOXP3 gene expression in the peripheral blood of patients with BC, their prognostic role, and applicability for early detection of BC.

Materials and Methods

In a cross-sectional study, 50 newly diagnosed BC patients from hospitals, affiliated to Shiraz University of Medical Sciences (Shiraz, Iran), were enrolled in the study from June 2014 to November 2016. The cancer diagnosis was confirmed via bladder biopsy during cystoscopy and histopathological examination. The type and stage of tumors were reported by an experienced pathologist. Patients with a positive history of other cancers, autoimmune diseases, and immune suppression were excluded from the study. The control group included 50 healthy age-matched individuals without any history of malignancy or autoimmune diseases. The sample size was determined in accordance with a previous study using Power SSC software. 17

N = 2 ( Z 1 - α / 2 + Z 1-β ) 2 δ 2 / d 2

Where: n=Sample size, δ2=Variance within the population, d=Effect size, α=Significance level at 0.05, and β=Power of 80%. The standard deviation (SD) was 6.

The study was approved by the Ethics Committee of Shiraz University of Medical Sciences (code of ethics: IR-SUMS.REC.1389.1798). All procedures were set up and performed at the Institute for Cancer Research (ICR), Shiraz University of Medical Sciences, Shiraz, Iran. Written informed consent was obtained from all the participants prior to enrollment.

Blood Samples, RNA Extraction, and Reverse Transcription

Peripheral venous blood samples were obtained from the participants. The BC patients did not receive any radiotherapy, chemotherapy, or immunotherapy prior to sampling. Total RNA of blood cells was extracted using lysis with ammonium chloride and by Trizol reagent (Invitrogen, USA), according to the manufacturer’s instructions. The quality and quantity of RNA samples were measured using spectrophotometry at 260 and 280 nm. Contaminated DNA was removed from the RNA using DNase I treatment (Fermentas, Lithuania) before cDNA synthesis. The cDNA was synthesized from 5 μg of total RNA with the RevertAid First Strand cDNA Synthesis Kit (Fermentas, Lithuania) using both oligo (dT) and random hexamer primers.

Quantitative Real-Time PCR (qRT-PCR)

Specific primers were designed to determine the expression of CTLA4, FOXP3, and β-actin using Primer-Blast online software. 18 The sequences of the designed primers are listed in table 1. The quantity and expression of target gene transcripts were determined using a Bio-Rad system (Chromo4 Real-time PCR Detector, Bio-Rad, USA) for quantitative RT-PCR. The expression of the β-actin housekeeping gene was used to normalize the target gene expression level. Every PCR reaction was done in a final volume of 20 μL, that contained 0.5 μg of cDNA product, 150 nM of each specific primer, and 1× reaction mixture consisting of SYBR green PCR Master Mix (Applied Biosystems, USA). Thermal cycling for all genes started with an initial denaturation step at 95 °C for 10 minutes, followed by 40 cycles of denaturation at 95 °C for 15 seconds, annealing at 56 °C for 20 seconds, and extension at 60 °C for one minute. The qRT-PCR amplification products were verified using melting curve analysis and 1% agarose gel electrophoresis. The amplification efficiency of PCR reaction for all transcripts was determined by plotting a standard curve. The relative quantities of target gene transcripts were calculated using the 2-ΔΔCt formula. 19

Target Gene Forward Primer Sequence Reverse Primer Sequence
Beta-actin GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG
CTLA4 CCCTGTCTTCTGCAAAGCAATGCA CAGCCTGCCGAAGCACTGTCA
FOXP3 CACCTGGAAGAACGCCATCC CTCATCCACGGTCCACACAG
Table 1.Sequences of forward and reverse primers for the detection of CTLA4 and FOXP3 genes in the patients and control groups

Statistical Analysis

Statistical Package for Social Science (SPSS) version 21.0 was used for data analysis. Relative expression was plotted and assessed with Prism 6 software (Inc; USA). Total amounts of target gene transcripts in the peripheral blood were compared to the equivalent values from the control samples using the nonparametric Mann-Whitney U test.

Results

In total, 100 individuals were allocated into two groups; patients with BC (n=50) and healthy age-matched controls (n=50). The mean age of the patients and the controls was 66.5±10.9 and 66.3±7.8 years, respectively. There was no age difference between the two studied groups (P=0.999). The histopathological information of BC patients included TNM stage, histological grade, vascular invasion, and muscular invasion (table 2).

Variable N (%)
TNM stage Ta 14 (28%)
I 11 (22%)
II 13 (26%)
III 6 (12%)
IV 1 (2%)
Undefined 5 (10%)
Histological grade I 1 (2%)
II 19 (38%)
III 8 (16%)
IV 17 (34%)
Undefined 5 (10%)
Vascular invasion Yes 20 (40%)
No 25 (50%)
Undefined 5 (10%)
Muscular invasion Yes 20 (40%)
No 25 (50%)
Undefined 5 (10%)
Table 2.Baseline characteristics of the patients with bladder cancer

Transcripts Level of CTLA4 and FOXP3 in BC Patients

The median of CTLA4 mRNA in BC patients and control groups was 4.04 and 1.00, respectively. A four-fold increase was observed for CTLA4 gene expression in the peripheral venous blood samples of BC patients compared with the control individuals (P=0.0002). In the BC patient’s group, the detected median of FOXP3 mRNA expression was 4.83, while it was 1.00 in the control group. The level of FOXP3 mRNA showed a 4.8-fold higher expression in BC patients than the control group (P=0.0075) (figure 1).

Figure 1. CTLA4 and FOXP3 genes transcript levels were detected in the peripheral blood of bladder cancer patients and control individuals. Both genes represent significantly higher expression in patients compared with controls. The graph shows whisker-box plot, and the data is compared with non-parametric Mann-Whitney test. **P<0.01; ***P<0.001

CTLA4 and FOXP3 Gene Expression and Tumor Stage

There was no correlation between BC stages and CTLA4 gene expression, while FOXP3 gene expression was decreased, when tumors had disseminated in subterranean tissues. The expression of FOXP3 mRNA was 10.5-fold higher in Ta, while the transcript level of FOXP3 was 2.6, 3.1, and 2.7-fold higher in patients with stage T1, T2, and T3 BC than the controls, respectively. Based on the Kruskal-Wallis test followed by Dunn’s multiple comparison test, the difference in FOXP3 mRNA expression between patients with stages Ta and T1 BC was statistically significant (P=0.026). The BC patients were divided into two sub-groups based on T stage and the patients with stage II (T2) or above were categorized as invasive BC. The median of CTLA4 transcript expression was 3.74 and 6.43 in patients with non-invasive and invasive BC, respectively (P=0.0016 and P=0.024, respectively, compared to the control group) (figure 2A). The median of FOXP3 mRNA expression in the peripheral blood samples of patients with non-invasive and invasive BC was 5.39 and 3.40, respectively. The difference in the FOXP3 gene expression in patients with non-invasive BC was statistically significant (P=0.009) (figure 2B).

Figure 2. The correlation between tumor stage and target genes mRNA transcript level. (A) CTLA4 gene showed significantly higher expression in both non-invasive and invasive BC patients compared with the control group. (B) FOXP3 gene showed significantly higher expression in non-invasive BC patients compared with the control group. All data were compared with Kruskal-Wallis test followed by Dunn’s multiple comparisons test. *P<0.05; ** P<0.01

CTLA4 and FOXP3 Gene Expression and Tumor Grade

The median of target gene mRNA expression in grade I/II (low-grade) and grade III/IV (high-grade) BC patients were 2.9 and 7.39 for CTLA4 and 6.61 and 2.73 for FOXP3, respectively. The expression of CTLA4 and FOXP3 genes were statistically correlated with the grade of bladder tumor cells, when compared to the control group. The results showed that the expressions of these genes, in particular CTLA4, were amplified by increasing the tumor grade (P=0.013 and P=0.0027) (figure 3). Furthermore, the muscular and vascular invasion of tumor cells were positively correlated with the mRNA levels of both genes in BC patients.

Figure 3. The correlation between tumor grade and target genes mRNA transcript level. The expressions of CTLA4 (A) and FOXP3 (B) genes were positively correlated with the various bladder cancer grades. Lines represent data range. All data were compared with Kruskal-Wallis test followed by Dunn’s multiple comparisons test. *P<0.05; **P<0.01

Discussion

Evaluation of CTLA4 and FOXP3 gene expression in the peripheral blood of BC patients revealed significant overexpression of both genes. CTLA4 and FOXP3 were significantly expressed in the early-stage and low-grade BC patients, indicating the applicability of these markers to detect early-stage BC.

The hypothesis of downregulation of the immune system in malignancies has attracted much attention to FOXP3, a unique transcription factor of Tregs. 20 , 21 High expression of this gene was detected in many malignancies such as gastric cancer. 22 , 23 The overexpression of FOXP3 and CTLA4 in the peripheral blood of patients with breast cancer was previously reported by our cancer research center. 17 However, high expression of FOXP3 in most malignancies have shown an opposite association with disease prognosis. 22 In line with our study, Zhang and colleagues evaluated FOXP3 in BC patients and showed a direct correlation between tumor staging and metastasis with this gene. 24 They found an inverse correlation between FOXP3 expression, patients’ survival, and response to chemotherapy. 24 FOXP3 can enhance hypoxia-inducible factor-1α (HIF-1α) in BC cells by influencing VEGF signaling and intratumoral immune responses. 25 Therefore, it is considered a poor prognostic factor for BC. Moreover, in patients with superficial BC, FOXP3 expression is associated with lower levels of intratumoral CD8+T cells. 25 In a study by Winerdal and colleagues, FOXP3 expression in urinary BC cells was associated with decreased long-term survival and thus, unfavorable prognosis. However, the presence of FOXP3 positive tumor infiltrating lymphocytes was positively correlated with good prognosis, since FOXP3 is also a T-cell activation marker. 26 In another study, an increase of Treg population in a tumor microenvironment of invasive BC was positively correlated with better prognosis due to the suppression of MMP2 gene expression. 27 They showed that MMP2 protein and mRNA expression was downregulated in a dose-dependent Treg-mediated manner in BC cells and the surrounding macrophages. They concluded that FOXP3 gene expression is positively correlated with better survival of patients with invasive BC. 27 Based on our results, we hypothesize that an increase of FOXP3 expression in BC patients is indicative of its screening potential of this malignancy. However, further studies with a larger sample size are required to confirm our findings.

In our previous study, we showed the presence of a significantly higher level of CTLA4 expression in the peripheral blood of breast cancer patients. 17 Previous reports showed downregulation of Tregs in BC with anti-CTLA4 treatment. 28 - 30 Based on this mechanism, ipilimumab is an approved drug with a good success rate in treating melanoma. 31 The results of the CheckMate-032, phase 1/2 trial, showed improved survival and tolerable side effects in 86 patients with metastatic BC, who received standard-of-care chemotherapy combined with a higher dosage of Yervoy (ipilimumab) together with Opdivo (nivolumab). 32 , 33 Anti-CTLA4 therapy increases the production of IFN-γ by enhancing T-cell responses, which is viewed as the main anti-tumor mechanism of this treatment pathway. 34 However, it has been shown that FOXP3+Tregs population did not decrease in the tumoral tissue of the bladder following anti-CTLA4 therapy. 35 However, it should be mentioned that anti-CTLA4 antibodies may act against Tregs through other mechanisms than antibody cell-mediated cytotoxicity. 36 Indeed, a major immune regulatory function of Treg was mediated by iTreg, which expresses a cytoplasmic variant of CTLA4, and escapes from antibody cell-mediated cytotoxicity through anti-CTLA4 antibodies. 36 Nevertheless, the impact of anti-CTLA4 antibodies has been confirmed in clinical trials. 33

The main limitation of the study was the inability of patient follow-up to assess the relationship between the level of FOXP3 and CTLA4 genes and disease recurrence.

Conclusion

FOXP3 and CTLA4 levels were significantly higher in patients with BC, especially in those with a low-grade and non-invasive type, indicating the importance of these molecules in BC screening. Although FOXP3 and CTLA4 gene expression levels may change in various types of cancers, the combination of a test based on these prognostic markers with other available tests may increase early detection of BC. Further studies with a larger sample size are required to confirm our findings.

Conflict of Interest

None declared.

References

  1. Wang CY, Hua R, Liu L, Zhan X, Chen S, Quan S, et al. Immunotherapy against metastatic bladder cancer by combined administration of granulocyte macrophage-colony stimulating factor and interleukin-2 surface modified MB49 bladder cancer stem cells vaccine. Cancer Med. 2017; 6:689-97. Publisher Full Text | DOI | PubMed
  2. Cao JY, Yin HS, Li HS, Yu XQ, Han X. Interleukin-27 augments the inhibitory effects of sorafenib on bladder cancer cells. Braz J Med Biol Res. 2017; 50:e6207. Publisher Full Text | DOI | PubMed
  3. Soubra A, Risk MC. Diagnostics techniques in nonmuscle invasive bladder cancer. Indian J Urol. 2015; 31:283-8. Publisher Full Text | DOI | PubMed
  4. Rakoff-Nahoum S. Why cancer and inflammation?. Yale J Biol Med. 2006; 79:123-30. Publisher Full Text | PubMed
  5. Bird JJ, Brown DR, Mullen AC, Moskowitz NH, Mahowald MA, Sider JR, et al. Helper T cell differentiation is controlled by the cell cycle. Immunity. 1998; 9:229-37. DOI | PubMed
  6. Liu YJ, Soumelis V, Watanabe N, Ito T, Wang YH, Malefyt Rde W, et al. TSLP: an epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation. Annu Rev Immunol. 2007; 25:193-219. DOI | PubMed
  7. Takeuchi Y, Nishikawa H. Roles of regulatory T cells in cancer immunity. Int Immunol. 2016; 28:401-9. Publisher Full Text | DOI | PubMed
  8. Chaudhary B, Elkord E. Regulatory T Cells in the Tumor Microenvironment and Cancer Progression: Role and Therapeutic Targeting. Vaccines (Basel). 2016; 4Publisher Full Text | DOI | PubMed
  9. Jozwicki W, Brozyna AA, Siekiera J, Slominski AT. Frequency of CD4+CD25+Foxp3+ cells in peripheral blood in relation to urinary bladder cancer malignancy indicators before and after surgical removal. Oncotarget. 2016; 7:11450-62. Publisher Full Text | DOI | PubMed
  10. Loskog A, Ninalga C, Paul-Wetterberg G, de la Torre M, Malmstrom PU, Totterman TH. Human bladder carcinoma is dominated by T-regulatory cells and Th1 inhibitory cytokines. J Urol. 2007; 177:353-8. DOI | PubMed
  11. Santoni G, Morelli MB, Amantini C, Battelli N. Urinary Markers in Bladder Cancer: An Update. Front Oncol. 2018; 8:362. Publisher Full Text | DOI | PubMed
  12. Sethi S, Sethi S, Bluth MH. Clinical Implication of MicroRNAs in Molecular Pathology: An Update for 2018. Clin Lab Med. 2018; 38:237-51. DOI | PubMed
  13. Salomo K, Huebner D, Boehme MU, Herr A, Brabetz W, Heberling U, et al. Urinary transcript quantitation of CK20 and IGF2 for the non-invasive bladder cancer detection. J Cancer Res Clin Oncol. 2017; 143:1757-69. DOI | PubMed
  14. Zhang M, Ren B, Li Z, Niu W, Wang Y. Expression of N-Myc Downstream-Regulated Gene 2 in Bladder Cancer and Its Potential Utility as a Urinary Diagnostic Biomarker. Med Sci Monit. 2017; 23:4644-9. Publisher Full Text | DOI | PubMed
  15. Springer SU, Chen CH, Rodriguez Pena MDC, Li L, Douville C, Wang Y, et al. Non-invasive detection of urothelial cancer through the analysis of driver gene mutations and aneuploidy. Elife. 2018; 7Publisher Full Text | DOI | PubMed
  16. Cohen JD, Li L, Wang Y, Thoburn C, Afsari B, Danilova L, et al. Detection and localization of surgically resectable cancers with a multi-analyte blood test. Science. 2018; 359:926-30. Publisher Full Text | DOI | PubMed
  17. Jaberipour M, Habibagahi M, Hosseini A, Habibabad SR, Talei A, Ghaderi A. Increased CTLA-4 and FOXP3 transcripts in peripheral blood mononuclear cells of patients with breast cancer. Pathol Oncol Res. 2010; 16:547-51. DOI | PubMed
  18. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012; 13:134. Publisher Full Text | DOI | PubMed
  19. BIO-RAD [Internet]. Real-Time PCR Applications Guide. [cited 3 December 2019]. Available at: https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_5279.pdf.
  20. Wang L, Liu R, Li W, Chen C, Katoh H, Chen GY, et al. Somatic single hits inactivate the X-linked tumor suppressor FOXP3 in the prostate. Cancer Cell. 2009; 16:336-46. Publisher Full Text | DOI | PubMed
  21. Barnes MJ, Griseri T, Johnson AM, Young W, Powrie F, Izcue A. CTLA-4 promotes Foxp3 induction and regulatory T cell accumulation in the intestinal lamina propria. Mucosal Immunol. 2013; 6:324-34. Publisher Full Text | DOI | PubMed
  22. Triulzi T, Tagliabue E, Balsari A, Casalini P. FOXP3 expression in tumor cells and implications for cancer progression. J Cell Physiol. 2013; 228:30-5. DOI | PubMed
  23. Zuo T, Wang L, Morrison C, Chang X, Zhang H, Li W, et al. FOXP3 is an X-linked breast cancer suppressor gene and an important repressor of the HER-2/ErbB2 oncogene. Cell. 2007; 129:1275-86. Publisher Full Text | DOI | PubMed
  24. Zhang H, Prado K, Zhang KX, Peek EM, Lee J, Wang X, et al. Biased Expression of the FOXP3Delta3 Isoform in Aggressive Bladder Cancer Mediates Differentiation and Cisplatin Chemotherapy Resistance. Clin Cancer Res. 2016; 22:5349-61. DOI | PubMed
  25. Jou YC, Tsai YS, Lin CT, Tung CL, Shen CH, Tsai HT, et al. Foxp3 enhances HIF-1alpha target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation. Oncotarget. 2016; 7:65403-17. Publisher Full Text | DOI | PubMed
  26. Winerdal ME, Marits P, Winerdal M, Hasan M, Rosenblatt R, Tolf A, et al. FOXP3 and survival in urinary bladder cancer. BJU Int. 2011; 108:1672-8. DOI | PubMed
  27. Winerdal ME, Krantz D, Hartana CA, Zirakzadeh AA, Linton L, Bergman EA, et al. Urinary Bladder Cancer Tregs Suppress MMP2 and Potentially Regulate Invasiveness. Cancer Immunol Res. 2018; 6:528-38. DOI | PubMed
  28. Carosella ED, Ploussard G, LeMaoult J, Desgrandchamps F. A Systematic Review of Immunotherapy in Urologic Cancer: Evolving Roles for Targeting of CTLA-4, PD-1/PD-L1, and HLA-G. Eur Urol. 2015; 68:267-79. DOI | PubMed
  29. Callahan MK, Postow MA, Wolchok JD. CTLA-4 and PD-1 Pathway Blockade: Combinations in the Clinic. Front Oncol. 2014; 4:385. Publisher Full Text | DOI | PubMed
  30. van Hooren L, Sandin LC, Moskalev I, Ellmark P, Dimberg A, Black P, et al. Local checkpoint inhibition of CTLA-4 as a monotherapy or in combination with anti-PD1 prevents the growth of murine bladder cancer. Eur J Immunol. 2017; 47:385-93. DOI | PubMed
  31. Postow MA, Callahan MK, Wolchok JD. Immune Checkpoint Blockade in Cancer Therapy. J Clin Oncol. 2015; 33:1974-82. Publisher Full Text | DOI | PubMed
  32. Carthon BC, Wolchok JD, Yuan J, Kamat A, Ng Tang DS, Sun J, et al. Preoperative CTLA-4 blockade: tolerability and immune monitoring in the setting of a presurgical clinical trial. Clin Cancer Res. 2010; 16:2861-71. Publisher Full Text | DOI | PubMed
  33. Sharma P, Callahan MK, Bono P, Kim J, Spiliopoulou P, Calvo E, et al. Nivolumab monotherapy in recurrent metastatic urothelial carcinoma (CheckMate 032): a multicentre, open-label, two-stage, multi-arm, phase 1/2 trial. Lancet Oncol. 2016; 17:1590-8. Publisher Full Text | DOI | PubMed
  34. Gao J, Shi LZ, Zhao H, Chen J, Xiong L, He Q, et al. Loss of IFN-gamma Pathway Genes in Tumor Cells as a Mechanism of Resistance to Anti-CTLA-4 Therapy. Cell. 2016; 167:397-404. Publisher Full Text | DOI | PubMed
  35. Sharma A, Subudhi SK, Blando J, Scutti J, Vence L, Wargo J, et al. Anti-CTLA-4 Immunotherapy Does Not Deplete FOXP3(+) Regulatory T Cells (Tregs) in Human Cancers. Clin Cancer Res. 2019; 25:1233-8. Publisher Full Text | DOI | PubMed
  36. Ferrara R, Susini S, Marabelle A. Anti-CTLA-4 Immunotherapy Does Not Deplete FOXP3(+) Regulatory T Cells (Tregs) in Human Cancers-Letter. Clin Cancer Res. 2019; 25:3468. DOI | PubMed